| Trees | Indices | Help |
|---|
|
|
Generic.Alignment --+
|
MultipleSeqAlignment
"Represents a classical multiple sequence alignment (MSA).
By this we mean a collection of sequences (usually shown as rows) which are all the same length (usually with gap characters for insertions of padding). The data can then be regarded as a matrix of letters, with well defined columns.
You would typically create an MSA by loading an alignment file with the AlignIO module:
>>> from Bio import AlignIO >>> align = AlignIO.read("Clustalw/opuntia.aln", "clustal") >>> print align SingleLetterAlphabet() alignment with 7 rows and 156 columns TATACATTAAAGAAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273285|gb|AF191659.1|AF191 TATACATTAAAGAAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273284|gb|AF191658.1|AF191 TATACATTAAAGAAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273287|gb|AF191661.1|AF191 TATACATAAAAGAAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273286|gb|AF191660.1|AF191 TATACATTAAAGGAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273290|gb|AF191664.1|AF191 TATACATTAAAGGAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273289|gb|AF191663.1|AF191 TATACATTAAAGGAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273291|gb|AF191665.1|AF191
In some respects you can treat these objects as lists of SeqRecord objects, each representing a row of the alignment. Iterating over an alignment gives the SeqRecord object for each row:
>>> len(align) 7 >>> for record in align: ... print record.id, len(record) gi|6273285|gb|AF191659.1|AF191 156 gi|6273284|gb|AF191658.1|AF191 156 gi|6273287|gb|AF191661.1|AF191 156 gi|6273286|gb|AF191660.1|AF191 156 gi|6273290|gb|AF191664.1|AF191 156 gi|6273289|gb|AF191663.1|AF191 156 gi|6273291|gb|AF191665.1|AF191 156
You can also access individual rows as SeqRecord objects via their index:
>>> print align[0].id gi|6273285|gb|AF191659.1|AF191 >>> print align[-1].id gi|6273291|gb|AF191665.1|AF191
And extract columns as strings:
>>> print align[:,1] AAAAAAA
Or, take just the first ten columns as a sub-alignment:
>>> print align[:,:10] SingleLetterAlphabet() alignment with 7 rows and 10 columns TATACATTAA gi|6273285|gb|AF191659.1|AF191 TATACATTAA gi|6273284|gb|AF191658.1|AF191 TATACATTAA gi|6273287|gb|AF191661.1|AF191 TATACATAAA gi|6273286|gb|AF191660.1|AF191 TATACATTAA gi|6273290|gb|AF191664.1|AF191 TATACATTAA gi|6273289|gb|AF191663.1|AF191 TATACATTAA gi|6273291|gb|AF191665.1|AF191
Combining this alignment slicing with alignment addition allows you to remove a section of the alignment. For example, taking just the first and last ten columns:
>>> print align[:,:10] + align[:,-10:] SingleLetterAlphabet() alignment with 7 rows and 20 columns TATACATTAAGTGTACCAGA gi|6273285|gb|AF191659.1|AF191 TATACATTAAGTGTACCAGA gi|6273284|gb|AF191658.1|AF191 TATACATTAAGTGTACCAGA gi|6273287|gb|AF191661.1|AF191 TATACATAAAGTGTACCAGA gi|6273286|gb|AF191660.1|AF191 TATACATTAAGTGTACCAGA gi|6273290|gb|AF191664.1|AF191 TATACATTAAGTATACCAGA gi|6273289|gb|AF191663.1|AF191 TATACATTAAGTGTACCAGA gi|6273291|gb|AF191665.1|AF191
Note - This object is intended to replace the existing Alignment object defined in module Bio.Align.Generic but is not fully backwards compatible with it.
Note - This object does NOT attempt to model the kind of alignments used in next generation sequencing with multiple sequencing reads which are much shorter than the alignment, and where there is usually a consensus or reference sequence with special status.
|
|||
|
|||
|
|||
|
|||
|
|||
|
|||
|
|||
|
|||
|
|||
|
Inherited from Inherited from |
|||
|
|||
Initialize a new MultipleSeqAlignment object.
Arguments:
records - A list (or iterator) of SeqRecord objects, whose sequences
are all the same length. This may be an be an empty list.
alphabet - The alphabet for the whole alignment, typically a gapped
alphabet, which should be a super-set of the individual
record alphabets. If omitted, a consensus alphabet is used.
You would normally load a MSA from a file using Bio.AlignIO, but you
can do this from a list of SeqRecord objects too:
>>> from Bio.Alphabet import generic_dna
>>> from Bio.Seq import Seq
>>> from Bio.SeqRecord import SeqRecord
>>> a = SeqRecord(Seq("AAAACGT", generic_dna), id="Alpha")
>>> b = SeqRecord(Seq("AAA-CGT", generic_dna), id="Beta")
>>> c = SeqRecord(Seq("AAAAGGT", generic_dna), id="Gamma")
>>> align = MultipleSeqAlignment([a, b, c])
>>> print align
DNAAlphabet() alignment with 3 rows and 7 columns
AAAACGT Alpha
AAA-CGT Beta
AAAAGGT Gamma
NOTE - The older Bio.Align.Generic.Alignment class only accepted a
single argument, an alphabet. This is still supported via a backwards
compatible "hack" so as not to disrupt existing scripts and users, but
this will in future be deprecated.
|
Add more SeqRecord objects to the alignment as rows. They must all have the same length as the original alignment, and have alphabets compatible with the alignment's alphabet. For example, >>> from Bio.Alphabet import generic_dna >>> from Bio.Seq import Seq >>> from Bio.SeqRecord import SeqRecord >>> from Bio.Align import MultipleSeqAlignment >>> a = SeqRecord(Seq("AAAACGT", generic_dna), id="Alpha") >>> b = SeqRecord(Seq("AAA-CGT", generic_dna), id="Beta") >>> c = SeqRecord(Seq("AAAAGGT", generic_dna), id="Gamma") >>> d = SeqRecord(Seq("AAAACGT", generic_dna), id="Delta") >>> e = SeqRecord(Seq("AAA-GGT", generic_dna), id="Epsilon") First we create a small alignment (three rows): >>> align = MultipleSeqAlignment([a, b, c]) >>> print align DNAAlphabet() alignment with 3 rows and 7 columns AAAACGT Alpha AAA-CGT Beta AAAAGGT Gamma Now we can extend this alignment with another two rows: >>> align.extend([d, e]) >>> print align DNAAlphabet() alignment with 5 rows and 7 columns AAAACGT Alpha AAA-CGT Beta AAAAGGT Gamma AAAACGT Delta AAA-GGT Epsilon Because the alignment object allows iteration over the rows as SeqRecords, you can use the extend method with a second alignment (provided its sequences have the same length as the original alignment). |
Add one more SeqRecord object to the alignment as a new row. This must have the same length as the original alignment (unless this is the first record), and have an alphabet compatible with the alignment's alphabet. >>> from Bio import AlignIO >>> align = AlignIO.read("Clustalw/opuntia.aln", "clustal") >>> print align SingleLetterAlphabet() alignment with 7 rows and 156 columns TATACATTAAAGAAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273285|gb|AF191659.1|AF191 TATACATTAAAGAAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273284|gb|AF191658.1|AF191 TATACATTAAAGAAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273287|gb|AF191661.1|AF191 TATACATAAAAGAAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273286|gb|AF191660.1|AF191 TATACATTAAAGGAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273290|gb|AF191664.1|AF191 TATACATTAAAGGAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273289|gb|AF191663.1|AF191 TATACATTAAAGGAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273291|gb|AF191665.1|AF191 >>> len(align) 7 We'll now construct a dummy record to append as an example: >>> from Bio.Seq import Seq >>> from Bio.SeqRecord import SeqRecord >>> dummy = SeqRecord(Seq("N"*156), id="dummy") Now append this to the alignment, >>> align.append(dummy) >>> print align SingleLetterAlphabet() alignment with 8 rows and 156 columns TATACATTAAAGAAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273285|gb|AF191659.1|AF191 TATACATTAAAGAAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273284|gb|AF191658.1|AF191 TATACATTAAAGAAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273287|gb|AF191661.1|AF191 TATACATAAAAGAAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273286|gb|AF191660.1|AF191 TATACATTAAAGGAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273290|gb|AF191664.1|AF191 TATACATTAAAGGAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273289|gb|AF191663.1|AF191 TATACATTAAAGGAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273291|gb|AF191665.1|AF191 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN...NNN dummy >>> len(align) 8 |
Combines to alignments with the same number of rows by adding them. If you have two multiple sequence alignments (MSAs), there are two ways to think about adding them - by row or by column. Using the extend method adds by row. Using the addition operator adds by column. For example, >>> from Bio.Alphabet import generic_dna >>> from Bio.Seq import Seq >>> from Bio.SeqRecord import SeqRecord >>> from Bio.Align import MultipleSeqAlignment >>> a1 = SeqRecord(Seq("AAAAC", generic_dna), id="Alpha") >>> b1 = SeqRecord(Seq("AAA-C", generic_dna), id="Beta") >>> c1 = SeqRecord(Seq("AAAAG", generic_dna), id="Gamma") >>> a2 = SeqRecord(Seq("GT", generic_dna), id="Alpha") >>> b2 = SeqRecord(Seq("GT", generic_dna), id="Beta") >>> c2 = SeqRecord(Seq("GT", generic_dna), id="Gamma") >>> left = MultipleSeqAlignment([a1, b1, c1]) >>> right = MultipleSeqAlignment([a2, b2, c2]) Now, let's look at these two alignments: >>> print left DNAAlphabet() alignment with 3 rows and 5 columns AAAAC Alpha AAA-C Beta AAAAG Gamma >>> print right DNAAlphabet() alignment with 3 rows and 2 columns GT Alpha GT Beta GT Gamma And add them: >>> print left + right DNAAlphabet() alignment with 3 rows and 7 columns AAAACGT Alpha AAA-CGT Beta AAAAGGT Gamma For this to work, both alignments must have the same number of records (here they both have 3 rows): >>> len(left) 3 >>> len(right) 3 The individual rows are SeqRecord objects, and these can be added together. Refer to the SeqRecord documentation for details of how the annotation is handled. This example is a special case in that both original alignments shared the same names, meaning when the rows are added they also get the same name. |
Access part of the alignment. Depending on the indices, you can get a SeqRecord object (representing a single row), a Seq object (for a single columns), a string (for a single characters) or another alignment (representing some part or all of the alignment). align[r,c] gives a single character as a string align[r] gives a row as a SeqRecord align[r,:] gives a row as a SeqRecord align[:,c] gives a column as a Seq (using the alignment's alphabet) align[:] and align[:,:] give a copy of the alignment Anything else gives a sub alignment, e.g. align[0:2] or align[0:2,:] uses only row 0 and 1 align[:,1:3] uses only columns 1 and 2 align[0:2,1:3] uses only rows 0 & 1 and only cols 1 & 2 We'll use the following example alignment here for illustration: >>> from Bio.Alphabet import generic_dna >>> from Bio.Seq import Seq >>> from Bio.SeqRecord import SeqRecord >>> from Bio.Align import MultipleSeqAlignment >>> a = SeqRecord(Seq("AAAACGT", generic_dna), id="Alpha") >>> b = SeqRecord(Seq("AAA-CGT", generic_dna), id="Beta") >>> c = SeqRecord(Seq("AAAAGGT", generic_dna), id="Gamma") >>> d = SeqRecord(Seq("AAAACGT", generic_dna), id="Delta") >>> e = SeqRecord(Seq("AAA-GGT", generic_dna), id="Epsilon") >>> align = MultipleSeqAlignment([a, b, c, d, e], generic_dna) You can access a row of the alignment as a SeqRecord using an integer index (think of the alignment as a list of SeqRecord objects here): >>> first_record = align[0] >>> print first_record.id, first_record.seq Alpha AAAACGT >>> last_record = align[-1] >>> print last_record.id, last_record.seq Epsilon AAA-GGT You can also access use python's slice notation to create a sub-alignment containing only some of the SeqRecord objects: >>> sub_alignment = align[2:5] >>> print sub_alignment DNAAlphabet() alignment with 3 rows and 7 columns AAAAGGT Gamma AAAACGT Delta AAA-GGT Epsilon This includes support for a step, i.e. align[start:end:step], which can be used to select every second sequence: >>> sub_alignment = align[::2] >>> print sub_alignment DNAAlphabet() alignment with 3 rows and 7 columns AAAACGT Alpha AAAAGGT Gamma AAA-GGT Epsilon Or to get a copy of the alignment with the rows in reverse order: >>> rev_alignment = align[::-1] >>> print rev_alignment DNAAlphabet() alignment with 5 rows and 7 columns AAA-GGT Epsilon AAAACGT Delta AAAAGGT Gamma AAA-CGT Beta AAAACGT Alpha You can also use two indices to specify both rows and columns. Using simple integers gives you the entry as a single character string. e.g. >>> align[3,4] 'C' This is equivalent to: >>> align[3][4] 'C' or: >>> align[3].seq[4] 'C' To get a single column (as a string) use this syntax: >>> align[:,4] 'CCGCG' Or, to get part of a column, >>> align[1:3,4] 'CG' However, in general you get a sub-alignment, >>> print align[1:5,3:6] DNAAlphabet() alignment with 4 rows and 3 columns -CG Beta AGG Gamma ACG Delta -GG Epsilon This should all seem familiar to anyone who has used the NumPy array or matrix objects.
|
Sort the rows (SeqRecord objects) of the alignment in place. This sorts the rows alphabetically using the SeqRecord object id. Currently no advanced sort options are available, although this may be added in a future release of Biopython. This is useful if you want to add two alignments which use the same record identifiers, but in a different order. For example, >>> from Bio.Alphabet import generic_dna >>> from Bio.Seq import Seq >>> from Bio.SeqRecord import SeqRecord >>> from Bio.Align import MultipleSeqAlignment >>> align1 = MultipleSeqAlignment([ ... SeqRecord(Seq("ACGT", generic_dna), id="Human"), ... SeqRecord(Seq("ACGG", generic_dna), id="Mouse"), ... SeqRecord(Seq("ACGC", generic_dna), id="Chicken"), ... ]) >>> align2 = MultipleSeqAlignment([ ... SeqRecord(Seq("CGGT", generic_dna), id="Mouse"), ... SeqRecord(Seq("CGTT", generic_dna), id="Human"), ... SeqRecord(Seq("CGCT", generic_dna), id="Chicken"), ... ]) If you simple try and add these without sorting, you get this: >>> print align1 + align2 DNAAlphabet() alignment with 3 rows and 8 columns ACGTCGGT <unknown id> ACGGCGTT <unknown id> ACGCCGCT Chicken Consult the SeqRecord documentation which explains why you get a default value when annotation like the identifier doesn't match up. However, if we sort the alignments first, then add them we get the desired result: >>> align1.sort() >>> align2.sort() >>> print align1 + align2 DNAAlphabet() alignment with 3 rows and 8 columns ACGCCGCT Chicken ACGTCGTT Human ACGGCGGT Mouse |
Returns a string containing a given column (OBSOLETE). This is a method provided for backwards compatibility with the old Bio.Align.Generic.Alignment object. You are encouraged to use the slice notation instead.
|
Add a sequence to the alignment (OBSOLETE). The start, end, and weight arguments are not supported! This method only provides limited backwards compatibility with the old Bio.Align.Generic.Alignment object. You are encouraged to use the append method with a SeqRecord instead.
|
| Trees | Indices | Help |
|---|
| Generated by Epydoc 3.0.1 on Wed Jul 14 01:49:25 2010 | http://epydoc.sourceforge.net |