The *fastq* sequence format
===========================

.. _classical-fastq:

.. note::

    This article uses material from the Wikipedia article 
    `FASTQ format <http://en.wikipedia.org/wiki/FASTQ_format>`
    which is released under the 
    `Creative Commons Attribution-Share-Alike License 3.0 <http://creativecommons.org/licenses/by-sa/3.0/>`

**fastq format** is a text-based format  for storing both a biological sequence 
(usually nucleotide sequence) and its corresponding quality scores.
Both the sequence letter and quality score are encoded with a single
ASCII character for brevity. It was originally developed at the `Wellcome Trust Sanger
Institute` to bundle a
:ref:`fasta <classical-fasta>` sequence and its quality data, but has recently
become the *de facto* standard for storing the output of high throughput
sequencing instruments such as the Illumina Genome
Analyzer Illumina. [1]_

Format
------

A fastq file normally uses four lines per sequence.

-  Line 1 begins with a '@' character and is followed by a sequence
   identifier and an *optional* description (like a
   :ref:`fasta <classical-fasta>` title line).
-  Line 2 is the raw sequence letters.
-  Line 3 begins with a '+' character and is *optionally* followed by
   the same sequence identifier (and any description) again.
-  Line 4 encodes the quality values for the sequence in Line 2, and
   must contain the same number of symbols as letters in the sequence.

A fastq file containing a single sequence might look like this:

::

    @SEQ_ID
    GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
    +
    !''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65

The character '!' represents the lowest quality while '~' is the
highest. Here are the quality value characters in left-to-right
increasing order of quality (`ASCII`):

::

     !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~

The original Sanger FASTQ files also allowed the sequence and quality
strings to be wrapped (split over multiple lines), but this is generally
discouraged as it can make parsing complicated due to the unfortunate
choice of "@" and "+" as markers (these characters can also occur in the
quality string).


Variations
----------

Quality
~~~~~~~

A quality value *Q* is an integer mapping of *p* (i.e., the probability
that the corresponding base call is incorrect). Two different equations
have been in use. The first is the standard Sanger variant to assess
reliability of a base call, otherwise known as Phred quality
score:

:math:`Q_\text{sanger} = -10 \, \log_{10} p`

The Solexa pipeline (i.e., the software delivered with the Illumina
Genome Analyzer) earlier used a different mapping, encoding the
odds *p*/(1-*p*) instead of the probability *p*:

:math:`Q_\text{solexa-prior to v.1.3} = -10 \, \log_{10} \frac{p}{1-p}`

Although both mappings are asymptotically identical at higher quality
values, they differ at lower quality levels (i.e., approximately *p* >
0.05, or equivalently, *Q* < 13).

|Relationship between *Q* and *p* using the Sanger (red) and Solexa
(black) equations (described above). The vertical dotted line indicates
*p* = 0.05, or equivalently, *Q*  13.|


Encoding
~~~~~~~~

-  Sanger format can encode a Phred quality
   score from 0 to 93 using ASCII 33 to 126
   (although in raw read data the Phred quality score rarely exceeds 60,
   higher scores are possible in assemblies or read maps). 
-  Solexa/Illumina 1.0 format can encode a Solexa/Illumina quality score
   from -5 to 62 using ASCII 59 to 126 (although in raw read
   data Solexa scores from -5 to 40 only are expected)
-  Starting with Illumina 1.3 and before Illumina 1.8, the format
   encoded a Phred quality score from 0 to 62
   using ASCII 64 to 126 (although in raw read data Phred
   scores from 0 to 40 only are expected).
-  Starting in Illumina 1.5 and before Illumina 1.8, the Phred scores 0
   to 2 have a slightly different meaning. The values 0 and 1 are no
   longer used and the value 2, encoded by ASCII 66 "B".

Sequencing Control Software, Version 2.6, Catalog # SY-960-2601, Part #
15009921 Rev. A, November
2009]\ http://watson.nci.nih.gov/solexa/Using_SCSv2.6_15009921_A.pdf\ 
(page 30) states the following: *If a read ends with a segment of mostly
low quality (Q15 or below), then all of the quality values in the
segment are replaced with a value of 2 (encoded as the letter B in
Illumina's text-based encoding of quality scores)... This Q2 indicator
does not predict a specific error rate, but rather indicates that a
specific final portion of the read should not be used in further
analyses.* Also, the quality score encoded as "B" letter may occur
internally within reads at least as late as pipeline version 1.6, as
shown in the following example:

::

    @HWI-EAS209_0006_FC706VJ:5:58:5894:21141#ATCACG/1
    TTAATTGGTAAATAAATCTCCTAATAGCTTAGATNTTACCTTNNNNNNNNNNTAGTTTCTTGAGATTTGTTGGGGGAGACATTTTTGTGATTGCCTTGAT
    +HWI-EAS209_0006_FC706VJ:5:58:5894:21141#ATCACG/1
    efcfffffcfeefffcffffffddf`feed]`]_Ba_^__[YBBBBBBBBBBRTT\]][]dddd`ddd^dddadd^BBBBBBBBBBBBBBBBBBBBBBBB

An alternative interpretation of this ASCII encoding has been
proposed.  Also, in Illumina runs using PhiX controls, the character
'B' was observed to represent an "unknown quality score". The error rate
of 'B' reads was roughly 3 phred scores lower the mean observed score of
a given run.

-  Starting in Illumina 1.8, the quality scores have basically returned
   to the use of the Sanger format (Phred+33).

File extension
--------------

There is no standard file extension for a FASTQ
file, but .fq and .fastq, are commonly used.

See also
--------

-  :ref:`fasta <classical-fasta>`

References
----------

.. [1]
   Cock et al (2009) The Sanger FASTQ file format for sequences with
   quality scores, and the Solexa/Illumina FASTQ variants. Nucleic Acids
   Research, 

.. [2]
   Illumina Quality Scores, Tobias Mann, Bioinformatics, San Diego,
   Illumina `1 <http://seqanswers.com/forums/showthread.php?t=4721>`__

.. |Relationship between *Q* and *p* using the Sanger (red) and Solexa (black) equations (described above). The vertical dotted line indicates *p* = 0.05, or equivalently, *Q*  13.| image:: Probability metrics.png

See http://en.wikipedia.org/wiki/FASTQ_format

